اولین گزارش از وقوع ویروس ساقه گودکی سیب از درختان سیب ایران

نوع مقاله: مقاله کامل پژوهشی

نویسنده

نویسنده

چکیده

طی دو سال زراعی 1391 و 1392 به منظور بررسی آلودگی درختان سیب به ویروس ساقه گودکی سیب (Apple stem pitting virus, ASPV) از نهالستان‌ها و باغ‌های واقع در استان‌های تهران، اصفهان، آذربایجان غربی، البرز، قزوین، همدان، مازندران، مرکزی، و لرستان نمونه‌برداری تصادفی انجام شد. مجموعه‌ای شامل 1053 نمونه جمع آوری شده با استفاده از آزمون سرولوژیکی الایزای مستقیم (DAS-ELISA) و کیت تجاری ASPV (بایوربا- سوئیس) مورد بررسی قرار گرفتند. نتایج این تحقیق نشان داد 54 نمونه سیب (12/5%) به ASPV آلوده بودند. تمام نمونه‌های مثبت در واکنش الایزا متعلق به نمونه‌های برگی از درختان سیب گلاب (Gala apple)، دارای علائم بدشکلی و پیسک خفیف بودند (شکل 1). بیشترین شیوع ویروس ASPV در استان البرز (8/13%) مشاهده شد و بعد از آن استان‌های تهران (4/11%)، مرکزی (2/7%)، همدان (1/7%)،لرستان (7%)، قزوین (5/6%) و مازندران (8/4%) قرار داشتند در  اصفهان و آذربایجان غربی نمونه مثبت مشاهده نشد. به منظور تایید شناسایی ویروس، آر ان ای کل از تعداد 54 نمونه‌ برگی با استفاده از روش توصیف شده چانگ و همکاران (1993) استخراج شد و واکنش RT-PCR با استفاده از آغازگر‌های اختصاصی ویروس ASPV (رس شمار بانک ژن، D21828) جهت تکثیر بخشی از منطقه ژنی رمز کننده پروتئین پوششی ویروس انجام پذیرفت. آغازگر‌های پیش سو (ASPV sense)5΄ATGTCTGGAACCTCATGCTGCAA 3΄ در موقعیت 8895-8869 و پس سو (ASPV antisense)5΄TTGGGATCAACTTTACTAAAAAGCATAA 3΄ در موقعیت 9238-9211 (Menzel et al. 2002)، دی ان ای ویروسی به اندازه 370 جفت باز شامل بخشی از ژن رمز کننده پروتئین پوششی ویروس را در نمونه‌های آلوده تکثیر نمودند (شکل 2). براساس اطلاعات موجود، گزارش حاضر اولین گزارش از وقوع این ویروس در ایران است.

کلیدواژه‌ها


عنوان مقاله [English]

FIRST REPORT OF Apple stem pitting virus INFECTION OF APPLE TREES IN IRAN

نویسنده [English]

  • F. S. ABTAHI
چکیده [English]

During 2012-2013, a survey for the presence of Apple stem pitting virus (ASPV) in apple (Malus domestica) was conducted in Tehran, Isfahan, West Azerbaijan, Alborz, Ghazvin, Hamedan, Mazandaran, Markazi, and Lorestan provinces. Leaf Samples were taken from 1053 randomly selected apple trees and tested by DAS-ELISA for the presence of ASPV using polyclonal antisera (Bioreba, Switzerland). ASPV was found in 54 apple samples (5.12%). All of the positive samples came from Gala apple trees with mottled and malformed leaves (Fig. 1, see Farsi section). The highest incidence of ASPV was in the province of Alborz (13.8%), followed by Tehran (11.4%), Markazi (7.2%), Hamedan (7.1%), Lorestan (7%), Ghazvin (6.5%), and Mazandaran (4.8%). None of the samples from West Azerbaijan and Isfahan showed positive reaction. To confirm virus identification, total RNA was extracted from 54 leaf samples (Chang et al., 1993) and subjected to RT-PCR using primers specific for a part of the ASPV (GenBank accession No. D21828) coat protein gene. ASPV sense (5’-ATGTCTGGAACCTCATGCTGCAA-3’, position 8869-8895 nt) and ASPV antisense (5’-TTGGGATCAACTTTACTAAAAAGCATAA-3’, position 9211-9238 nt) (Menzel et al., 2002). A 370 bp DNA fragment was amplified from extracts of infected trees but not from those of healthy trees. To the best of our knowledge, this is the first report of ASPV in apple trees in Iran.

کلیدواژه‌ها [English]

  • -