جدایه جدید Spiroplasma citri جدا شده از زنجرک Circulifer haematoceps در استان فارس

نوع مقاله: گزارش کوتاه

نویسندگان

نویسنده

چکیده

جدایه‌های Spiroplasma citri براساس تحرک الکتروفورزی پروتئین و RFLP ژن اسپیرالین به پنج گروه تقسیم شده‌اند (Foissac et al. 1996). در این گزارش دو جدایه جدید S. citri که واجدشرایط برای پایه‌گذاری گروه ششم هستند معرفی می‌گردد. پیش از این آلودگی S. citri در گیاه کنجد گزارش شده بود (Salehi and Izadpanah 2002). نمونه‌های زنجرک ناقل (Salehi et al.1993) آلوده بهS. citri از مناطق مختلف استان فارس جمع‌آوری شدند. حشرات ناقل آلوده (Circulifer haematoceps) جهت انتقال  S. citri روی گیاه پروانش (Catharanthus roseus) نگه‌داری شدند. وجود آلودگی در نمونه‌های گیاهی جمع آوری شده  از باغ‌ها و گیاهانی که توسط زنجرک ناقل و در شرایط گلخانه آلوده شده بودند با استفاده از آنتی سرم محلی که بر علیه جدایه S. citri تهیه شده بود تأیید شد. محیط  LD10(Lee and Davis 1984) جهت جداسازی بیمارگر از نمونه‌های آلوده مورد استفاده قرار گرفت. واکنش زنجیره ای پلیمراز با استفاده از جفت آغازگر F1R1 (TAATTTTAATAACATTTGCTT3´,535-GTTCTAAATAAGAAAAAGTTT-) که ژن اسپیرالین را تکثیر می‌کند انجام شد. محصول PCR در باکتری E. coli همسانه‌سازی وتعیین ترادف گردید. آنالیز RFLP ژن اسپیرالین نشان داد که اکثر جدایه‌های S. ctri در گروه یک قرار می‌گیرند اما دو جدایه اسپیروپلاسما که از زنجرک Circulifer haematocepsاز مزارع کنجد جدا شده بودند با هیچ یک از این پنج گروه تطابق نداشتند. ژن اسپیرالین در هر دو جدایه (Acc. No. FJ755921 and FJ755922.) دارای 93 درصد همولوژی با جدایه GII3بود و توانایی رمزگذاری 244 آمینو اسید را داشت. این در حالی است که جدایه‌های گروه یک تا چهار تعداد 241 و جدایه گروه پنج 242 آمینو اسید را رمزگذاری می‌کنند. از طرف دیگر آنالیز RFLP ژن اسپیرالین نشان داد که این دو جدایه دارای یک جایگاه برشی اضافی با آنزیم  MboIدر موقعیت نوکلئوتید شماره 456 به همراه تغییر در موقعیت دیگر جایگاه‌های برشی می‌باشد. این نتایج با الکتروفورز پروتئین در ژل آکریل آمید مورد تایید قرار گرفت. اندازه پروتئین اسپیرالین در این دو جدایه kDa8/22 بوددر حالی که اندازه این پروتئین در جدایه پالمیر kDa 32 و در جدایه‌های گروه‌های یک تا چهار kDa 5/28- 24 گزارش شده است. بنابراین با توجه به داده‌های موجود (Foissac et al. 1996) این دو جدایه را می‌توان در یک گروه جداگانه (گروه شش) قرار داد.



 

عنوان مقاله [English]

NOVEL ISOLATE OF Spiroplasma citri FROM LEAFHOPPER Circulifer haematoceps FROM FARS PROVINCE

نویسندگان [English]

  • A. KHANCHEZAR
  • K. IZADPANAH
  • M. SALEHI
  • S. M. TAGHAVI
چکیده [English]

 
Strains of Spiroplasma citri have been classified into five groups based on electrophoretic mobility (EM) of spiralin protein and RFLP analysis of spiralin gene (Foissac et al. 1996). In the present study, two isolates of S. citri qualifying for formation of a sixth group are reported. Infection of sesame plants by S. citri has been reported previously (Salehi and Izadpanah 2002). Samples of vector (Circulifer haematoceps) leafhoppers (Salehi et al.1993) were collected in various regions in Fars province of Iran. The insects  were caged on periwinkle (Catharanthus roseus) plants. Presence of S. citri in collected plant samples and vector-inoculated plants was verified by ELISA using a locally produced polyclonal antiserum against a citrus isolate of S. citri. ELISA-positive samples were used to isolate S. citri in culture medium LD10 (Lee and Davis 1984). S. citri grown in culture was used to amplify spiralin gene by PCR using specific primer pair F1/R1 (5´ -TAATTTTAATAACATTTGCTT-3´/5-´ GTTCTAAATAAGAAAAAGTTT-3´). The amplified products were cloned in E. coli and sequenced. RFLP analysis showed that most isolates fell into group I of S. citri strains but two isolates originally obtained from C. haematoceps in a sesame field and propagated in periwinkle (Catharanthus roseus) did not match any of the five groups. The spiralin gene in both isolates (Acc. No. FJ755921 and FJ755922.) had only 93 percent homology with that of GII3 strain and could code for 244 amino acids (aa) instead of 241 aa in strains of groups 1-4 and 242 aa in a group 5 (Palmyre) strain. RFLP analysis showed that the leafhopper isolates had one additional MboI restriction site at nucleotide 456 plus changes in the position of certain other restriction sites. These results were confirmed by electrophoresis in polyacrylamide gel in which the spiralin protein from both insect isolates showed a different EM and banded at 28.8 kDa compared to 32 kDa for palmyre isolate and 24-28.5 reported for groups 1-4. By the current criteria (Foissac et al. 1996) the two new isolates qualify for forming a new group (group 6) of S. citri strains from Iran.